Abstract #M100
Section: Breeding and Genetics (posters)
Session: Breeding and Genetics I
Format: Poster
Day/Time: Monday 7:30 AM–9:30 AM
Location: Exhibit Hall A
Session: Breeding and Genetics I
Format: Poster
Day/Time: Monday 7:30 AM–9:30 AM
Location: Exhibit Hall A
# M100
Allele frequency of β-casein gene in local dairy animals of Pakistan.
Ghulam Bilal*1, Muhammad Moaeen-ud-Din1, 1Laboratories of Animal Breeding and Genetics, Faculty of Veterinary and Animal Sciences, PMAS Arid Agriculture University, Rawalpindi, Rawalpindi, Punjab, Pakistan.
Key Words: dairy animal, β-casein, Pakistan
Allele frequency of β-casein gene in local dairy animals of Pakistan.
Ghulam Bilal*1, Muhammad Moaeen-ud-Din1, 1Laboratories of Animal Breeding and Genetics, Faculty of Veterinary and Animal Sciences, PMAS Arid Agriculture University, Rawalpindi, Rawalpindi, Punjab, Pakistan.
The objective of the present study was to identify the genotypes of our leading dairy cattle and buffalo breeds concerning A1 and A2 β-casein bovine milk protein. Blood samples were collected from local dairy cattle [Sahiwal (n = 13), Cholistani (n = 12), Holstein (n = 42), Crossbred (n = 18)] and buffalo (Nili Ravi; n = 15) bulls. DNA was extracted through GeneJet Genomic DNA Purification Mini kit (Thermoscientific, EU, Lithuania). Allele-specific primers for A1 and A2 alleles of β casein gene were designed using Primer Premiere (Ver. 6.0). Primers sequences used for A1 allele were (forward) CCCTTCCCTGGGCCCATCCC and (reverse) TCAGTGAGAGTCAGGCTCTGG and for A2 allele were (forward) TCCCTTCCCTGGGCCCATCCC and (reverse) TCAGTGAGAGTCAGGCTCTGG. PCR (Proflex, Singapore) was performed at annealing temperature of 57°C for all primers and all samples. Briefly, the PCR mix had total volume of reaction mixture of 20 µL, including 10 µL of (2×) master mix, 7 µL of PCR water, 2 µL of primer (both forward and reverse) and 1 µL of extracted DNA template. After completing PCR, the PCR products were subjected to Gel Electrophoresis (Cleaver Scientific, UK). Briefly, 3 µL of PCR product was run on agarose gel (2%) at 90 V for 90 min and visualized in UV light in Gel Doc system (Syngene, UK). Bands with the specific band size were seen under UV light and confirmed for A1 and A2 by sequencing from Macrogen (Korea). The preliminary results suggest that our major dairy cattle and buffalo breeds (i.e., Sahiwal, Cholistani, and Nili Ravi) have desirable (A2A2) genotype and consumption of milk from our local breeds is healthier and safe. Moreover, crossbred and Holstein dairy animal present in the country have considerable presence of undesirable A1A1 or A1A2 genotypes (i.e., 0.17 and 0.74, respectively), indicating that import of exotic animals and crossing/inseminating local cows with exotic semen could result in the introduction of the undesirable and unhealthy β-casein A1 allele in the local dairy populations.
Table 1. Frequency of A1A1, A1A2, and A2A2 genotypes among major local and exotic dairy animals in Pakistan
Species and breed | Sample | Genotype frequency | ||
A1A1 | A1A2 | A2A2 | ||
Dairy cattle | ||||
Sahiwal | 13 | 0.00 | 0.00 | 1.00 |
Cholistani | 12 | 0.08 | 0.00 | 0.92 |
Cross-bred | 18 | 0.00 | 0.17 | 0.83 |
Holstein | 42 | 0.07 | 0.67 | 0.26 |
Buffalo | ||||
Nili-Ravi | 15 | 0.00 | 0.00 | 1.00 |
Key Words: dairy animal, β-casein, Pakistan